Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCTCCGAGGCCTGTGTGCCAACAC[C/T]GTGCTGCGCTTTCTGGACTTAAAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606236 MIM: 602050 MIM: 615128 | ||||||||||||||||||||
Literature Links: |
ASPSCR1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ASPSCR1 - ASPSCR1, UBX domain containing tether for SLC2A4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRC45 - leucine rich repeat containing 45 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_144999.3 | 600 | Silent Mutation | ACC,ACT | T,T 86 | NP_659436.1 |
RAC3 - ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STRA13 - stimulated by retinoic acid 13 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |