Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCAGGGGCTACGTGGGCACCGGGC[A/G]CTTGTCCTGGAAGAAGCGCTTGAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602378 MIM: 605395 | ||||||||||||||||||||
Literature Links: |
C19orf38 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C19orf38 - chromosome 19 open reading frame 38 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DNM2 - dynamin 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6793 - microRNA 6793 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMED1 - transmembrane p24 trafficking protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006858.3 | 783 | Missense Mutation | CGC,TGC | R,C 223 | NP_006849.1 | |
XM_006722631.3 | 783 | Missense Mutation | CGC,TGC | R,C 185 | XP_006722694.1 |