Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGCCATGTCCCCTATCTGCGGGGT[A/G]TCCACTTGCGTTTGGCCCTCCCGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611951 MIM: 190180 | ||||||||||||||||||||
Literature Links: |
B9D2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
B9D2 - B9 protein domain 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_030578.3 | 361 | Silent Mutation | GAC,GAT | D,D 47 | NP_085055.2 | |
XM_011527349.2 | 361 | Silent Mutation | GAC,GAT | D,D 47 | XP_011525651.1 | |
XM_011527350.1 | 361 | UTR 5 | XP_011525652.1 |
TGFB1 - transforming growth factor beta 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM91 - transmembrane protein 91 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |