Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCAAGCCTGTGTCCCACAGGTCCT[C/T]GGCGCAGTGGAAGTCAGCTGTCCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607246 | ||||||||||||||||||||
Literature Links: |
AP3D1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AP3D1 - adaptor related protein complex 3 delta 1 subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IZUMO4 - IZUMO family member 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001031735.2 | 577 | Missense Mutation | TCG,TTG | S,L 160 | NP_001026905.2 | |
NM_001039846.1 | 577 | Missense Mutation | TCG,TTG | S,L 160 | NP_001034935.1 | |
XM_005259480.3 | 577 | Missense Mutation | TCG,TTG | S,L 160 | XP_005259537.2 |
MOB3A - MOB kinase activator 3A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |