Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCTCACCTGGCACTGGTCGCAGTG[C/T]TCACCCATGTTCTCCTCATCACAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 142705 MIM: 603144 MIM: 606936 | ||||||||||||||||||||
Literature Links: |
HRC PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HRC - histidine rich calcium binding protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002152.2 | 2140 | Silent Mutation | GAA,GAG | E,E 651 | NP_002143.1 | |
XM_017026733.1 | 2140 | UTR 3 | XP_016882222.1 |
PPFIA3 - PTPRF interacting protein alpha 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRPM4 - transient receptor potential cation channel subfamily M member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |