Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCCTCTAATCCCCCACTTAGACG[C/G]GTGGACTTCCCGCTGGATCGAATCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 109091 MIM: 602918 MIM: 600061 | ||||||||||||||||||||
Literature Links: |
CALR PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CALR - calreticulin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004343.3 | 175 | Missense Mutation | GCG,GGG | A,G 32 | NP_004334.1 |
FARSA - phenylalanyl-tRNA synthetase alpha subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6515 - microRNA 6515 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAD23A - RAD23 homolog A, nucleotide excision repair protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |