Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCCATGGGGGCATATACGTGTGCC[A/G]GGTCCAGGAGGGCAACGAGTCATAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601855 MIM: 112205 MIM: 603474 | ||||||||||||||||||||
Literature Links: |
ARHGEF1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARHGEF1 - Rho guanine nucleotide exchange factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CD79A - CD79a molecule | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001783.3 | 505 | Missense Mutation | CAG,CGG | Q,R 107 | NP_001774.1 | |
NM_021601.3 | 505 | Intron | NP_067612.1 |
MIR6797 - microRNA 6797 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS19 - ribosomal protein S19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |