Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCATTGTGTTTATGTTTTCAATCC[A/G]CTTTCCTGGAACTGGGCCGGGCACA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612082 MIM: 603074 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CIC PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CIC - capicua transcriptional repressor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PAFAH1B3 - platelet activating factor acetylhydrolase 1b catalytic subunit 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145939.1 | Intron | NP_001139411.1 | ||||
NM_001145940.1 | Intron | NP_001139412.1 | ||||
NM_002573.3 | Intron | NP_002564.1 | ||||
XM_017026846.1 | Intron | XP_016882335.1 | ||||
XM_017026847.1 | Intron | XP_016882336.1 | ||||
XM_017026848.1 | Intron | XP_016882337.1 |
PRR19 - proline rich 19 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_199285.2 | Intron | NP_954979.2 | ||||
XM_005258779.4 | Intron | XP_005258836.2 | ||||
XM_005258780.3 | Intron | XP_005258837.1 | ||||
XM_006723154.3 | Intron | XP_006723217.1 | ||||
XM_011526787.1 | Intron | XP_011525089.1 | ||||
XM_011526788.1 | Intron | XP_011525090.1 | ||||
XM_011526789.2 | Intron | XP_011525091.1 | ||||
XM_011526790.2 | Intron | XP_011525092.1 |
TMEM145 - transmembrane protein 145 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |