Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCTTGCCCCGACCAGGACCAAAG[G/T]CTCATCTTGGAGCGGTTGCAGGTCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 137241 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
GIPR PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
GIPR - gastric inhibitory polypeptide receptor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000164.3 | 549 | Missense Mutation | AGG,AGT | R,S 131 | NP_000155.1 | |
NM_001308418.1 | 549 | Missense Mutation | AGG,AGT | R,S 95 | NP_001295347.1 | |
XM_011526709.2 | 549 | Missense Mutation | AGG,AGT | R,S 131 | XP_011525011.1 | |
XM_011526710.2 | 549 | Missense Mutation | AGG,AGT | R,S 131 | XP_011525012.1 | |
XM_011526711.2 | 549 | Missense Mutation | AGG,AGT | R,S 95 | XP_011525013.1 | |
XM_011526713.2 | 549 | Intron | XP_011525015.1 | |||
XM_011526714.2 | 549 | UTR 5 | XP_011525016.1 | |||
XM_011526715.2 | 549 | UTR 5 | XP_011525017.1 | |||
XM_011526716.2 | 549 | Missense Mutation | AGG,AGT | R,S 131 | XP_011525018.1 | |
XM_017026584.1 | 549 | Intron | XP_016882073.1 | |||
XM_017026585.1 | 549 | Intron | XP_016882074.1 | |||
XM_017026586.1 | 549 | Intron | XP_016882075.1 | |||
XM_017026587.1 | 549 | Intron | XP_016882076.1 |
MIR642A - microRNA 642a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR642B - microRNA 642b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |