Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAGGGAAGGAGACCACGGGGTCCA[C/T]ACCACGCGGGCAGCCAGGGAGCCGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 118860 MIM: 152780 MIM: 604788 | ||||||||||||||||||||
Literature Links: |
CGB3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CGB3 - chorionic gonadotropin beta subunit 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LHB - luteinizing hormone beta polypeptide | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000894.2 | Intron | NP_000885.1 | ||||
XM_011526975.1 | Intron | XP_011525277.1 |
LOC101059948 - uncharacterized LOC101059948 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6798 - microRNA 6798 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RUVBL2 - RuvB like AAA ATPase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321190.1 | Intron | NP_001308119.1 | ||||
NM_001321191.1 | Intron | NP_001308120.1 | ||||
NM_006666.2 | Intron | NP_006657.1 | ||||
XM_011526330.1 | Intron | XP_011524632.1 |