Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TATCCCTTTGTCGCCTCCCAACCCC[A/C]GTCATGGCTGAGTACGGGACCCTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 114250 MIM: 615820 MIM: 603434 | ||||||||||||||||||||
Literature Links: |
CASQ1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CASQ1 - calsequestrin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DCAF8 - DDB1 and CUL4 associated factor 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC729867 - uncharacterized LOC729867 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PEA15 - phosphoprotein enriched in astrocytes 15 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001297576.1 | Intron | NP_001284505.1 | ||||
NM_001297577.1 | Intron | NP_001284506.1 | ||||
NM_001297578.1 | Intron | NP_001284507.1 | ||||
NM_003768.4 | Intron | NP_003759.1 | ||||
XM_006711599.2 | Intron | XP_006711662.1 |