Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGATTTAGATCTGGGGGCTGGTGGG[A/G]GCCATAGCCTTGGCAGCTTGCTGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 611824 MIM: 605138 MIM: 609501 | ||||||||||||||||||||
Literature Links: |
MRPL9 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MRPL9 - mitochondrial ribosomal protein L9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001300733.1 | 1220 | Silent Mutation | GCC,GCT | A,A 227 | NP_001287662.1 | |
NM_031420.3 | 1220 | Silent Mutation | GCC,GCT | A,A 261 | NP_113608.1 |
OAZ3 - ornithine decarboxylase antizyme 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TDRKH - tudor and KH domain containing | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |