Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGTGGGGCAGACTGTTGGTGTAATT[A/G]TGCAAACTCGATCACTAGCTCTGCG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
17 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614542 MIM: 603634 MIM: 603635 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FAM69A PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FAM69A - family with sequence similarity 69 member A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001006605.4 | Intron | NP_001006606.2 | ||||
NM_001252269.1 | Intron | NP_001239198.1 | ||||
NM_001252270.1 | Intron | NP_001239199.1 | ||||
NM_001252271.1 | Intron | NP_001239200.1 | ||||
NM_001252273.1 | Intron | NP_001239202.1 |
RPL5 - ribosomal protein L5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000969.3 | Intron | NP_000960.2 |
SNORA66 - small nucleolar RNA, H/ACA box 66 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD21 - small nucleolar RNA, C/D box 21 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |