Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGCATGGATGTAAAACTCGTTTCA[C/G]TCGTTTCAAAGTGAGAGAGCTCTCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
7 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606366 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DUSP5P1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DUSP5P1 - dual specificity phosphatase 5 pseudogene 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105373132 - uncharacterized LOC105373132 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_011544354.2 | Intron | XP_011542656.1 |
RHOU - ras homolog family member U | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021205.5 | Intron | NP_067028.1 |
RNA5S15 - RNA, 5S ribosomal 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNA5S16 - RNA, 5S ribosomal 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNA5S17 - RNA, 5S ribosomal 17 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |