Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTGCAGCCATGTCCTCTTCCCCGT[C/G]GGAGCCTGCGACCCTGCGCCGGGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 184755 | ||||||||||||||||||||
Literature Links: |
ECHDC2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR1273F - microRNA 1273f | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR5095 - microRNA 5095 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCP2 - sterol carrier protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001007098.2 | 185 | Missense Mutation | TCG,TGG | S,W 6 | NP_001007099.1 | |
NM_001007099.2 | 185 | Intron | NP_001007100.1 | |||
NM_001007100.2 | 185 | Intron | NP_001007101.1 | |||
NM_001007250.2 | 185 | Intron | NP_001007251.1 | |||
NM_001193599.1 | 185 | Missense Mutation | TCG,TGG | S,W 6 | NP_001180528.1 | |
NM_001193600.1 | 185 | Missense Mutation | TCG,TGG | S,W 6 | NP_001180529.1 | |
NM_001193617.1 | 185 | UTR 5 | NP_001180546.1 | |||
NM_002979.4 | 185 | Missense Mutation | TCG,TGG | S,W 6 | NP_002970.2 | |
XM_005271103.4 | 185 | Missense Mutation | TCG,TGG | S,W 6 | XP_005271160.1 | |
XM_011541935.2 | 185 | Missense Mutation | TCG,TGG | S,W 6 | XP_011540237.1 | |
XM_017002045.1 | 185 | Missense Mutation | TCG,TGG | S,W 6 | XP_016857534.1 | |
XM_017002046.1 | 185 | Intron | XP_016857535.1 |