Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTCTGAGCCTTTCTACTCTGATGA[C/T]AAGATGGTGAGGACTTGCCACACAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
19 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 600923 MIM: 610554 MIM: 604729 | ||||||||||||||||||||
Literature Links: |
PPOX PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PPOX - protoporphyrinogen oxidase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UFC1 - ubiquitin-fold modifier conjugating enzyme 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USP21 - ubiquitin specific peptidase 21 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001014443.2 | 830 | Silent Mutation | GAC,GAT | D,D 198 | NP_001014443.1 | |
NM_001319848.1 | 830 | Silent Mutation | GAC,GAT | D,D 198 | NP_001306777.1 | |
NM_012475.4 | 830 | Silent Mutation | GAC,GAT | D,D 198 | NP_036607.3 | |
XM_011509414.1 | 830 | Silent Mutation | GAC,GAT | D,D 227 | XP_011507716.1 | |
XM_017001036.1 | 830 | Silent Mutation | GAC,GAT | D,D 227 | XP_016856525.1 | |
XM_017001037.1 | 830 | Silent Mutation | GAC,GAT | D,D 198 | XP_016856526.1 | |
XM_017001038.1 | 830 | Silent Mutation | GAC,GAT | D,D 198 | XP_016856527.1 | |
XM_017001039.1 | 830 | Silent Mutation | GAC,GAT | D,D 198 | XP_016856528.1 | |
XM_017001040.1 | 830 | Silent Mutation | GAC,GAT | D,D 227 | XP_016856529.1 | |
XM_017001041.1 | 830 | Silent Mutation | GAC,GAT | D,D 14 | XP_016856530.1 | |
XM_017001042.1 | 830 | Intron | XP_016856531.1 |