Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATGACCCAATCATCTTGTTTCCAG[C/T]TGGAAAGAGTGCCATCACCTGATCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 601902 MIM: 617031 MIM: 613692 | ||||||||||||||||||||
Literature Links: |
ORC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ORC1 - origin recognition complex subunit 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRPF38A - pre-mRNA processing factor 38A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032864.3 | 813 | Silent Mutation | CTG,TTG | L,L 204 | NP_116253.2 | |
XM_011542315.2 | 813 | Silent Mutation | CTG,TTG | L,L 204 | XP_011540617.1 |
ZCCHC11 - zinc finger CCHC-type containing 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |