Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGACATGTGAGGCTGTAGTCTCGGT[A/G]GTCGTTGTTGTCCCAGTACTCGGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603326 MIM: 604105 | ||||||||||||||||||||
Literature Links: |
FAM217B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM217B - family with sequence similarity 217 member B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001190826.1 | 1180 | Intron | NP_001177755.1 | |||
NM_001190827.1 | 1180 | Intron | NP_001177756.1 | |||
NM_022106.2 | 1180 | Intron | NP_071389.1 | |||
XM_011528985.2 | 1180 | Intron | XP_011527287.1 | |||
XM_011528986.2 | 1180 | Intron | XP_011527288.1 |
PPP1R3D - protein phosphatase 1 regulatory subunit 3D | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006242.3 | 1180 | Missense Mutation | CAC,TAC | H,Y 272 | NP_006233.1 |
SYCP2 - synaptonemal complex protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |