Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCAGCGCCTGCACTGACTCTTGGC[A/G]GGTAGTCGACTGCCCAGAGAGCTGC
Species: |
Human | |||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
6 submissions
|
|||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612920 | |||||||||||||||||||||||||||||||||||
Literature Links: |
KRTAP10-10 PubMed Links | |||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
AMR
|
|||||
EUR - Not Available |
KRTAP10-10 - keratin associated protein 10-10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_181688.2 | Intron | NP_859016.1 |
KRTAP10-11 - keratin associated protein 10-11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KRTAP10-9 - keratin associated protein 10-9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSPEAR - thrombospondin type laminin G domain and EAR repeats | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001272037.1 | Intron | NP_001258966.1 | ||||
NM_144991.2 | Intron | NP_659428.2 |