Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATTTTCACAATGGAAACAATTTAGG[A/G]CACTTGTGTACGGTTGGCTGGGCAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603294 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C21orf58 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C21orf58 - chromosome 21 open reading frame 58 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MCM3AP - minichromosome maintenance complex component 3 associated protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
YBEY - ybeY metallopeptidase (putative) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001006114.2 | Intron | NP_001006114.1 | ||||
NM_001314022.1 | Intron | NP_001300951.1 | ||||
NM_001314023.1 | Intron | NP_001300952.1 | ||||
NM_001314024.1 | Intron | NP_001300953.1 | ||||
NM_001314025.1 | Intron | NP_001300954.1 | ||||
NM_001314026.1 | Intron | NP_001300955.1 | ||||
NM_058181.2 | Intron | NP_478061.1 | ||||
XM_005261156.3 | Intron | XP_005261213.2 | ||||
XM_011529629.2 | Intron | XP_011527931.1 | ||||
XM_011529630.2 | Intron | XP_011527932.1 | ||||
XM_011529631.2 | Intron | XP_011527933.1 | ||||
XM_011529633.2 | Intron | XP_011527935.1 | ||||
XM_011529634.2 | Intron | XP_011527936.2 | ||||
XM_011529635.2 | Intron | XP_011527937.1 | ||||
XM_017028394.1 | Intron | XP_016883883.1 | ||||
XM_017028395.1 | Intron | XP_016883884.1 | ||||
XM_017028396.1 | Intron | XP_016883885.1 |