Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACATACCTGCTGTTCTTGAGTGGGG[C/T]AGTCTGTGGGCCTTGCTTTGTAGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612395 MIM: 601987 | ||||||||||||||||||||
Literature Links: |
CHKB PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CHKB - choline kinase beta | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005198.4 | 1126 | Missense Mutation | TAC,TGC | Y,C 303 | NP_005189.2 |
CHKB-AS1 - CHKB antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CHKB-CPT1B - CHKB-CPT1B readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CPT1B - carnitine palmitoyltransferase 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |