Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTGAGCCTGGAGGAGGACCTGAAG[A/G]AAGGGGCTTCCCGGGCCCAGACCAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615903 MIM: 185261 MIM: 605017 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C22orf15 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C22orf15 - chromosome 22 open reading frame 15 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_182520.2 | 1249 | Missense Mutation | AAA,GAA | K,E 58 | NP_872326.2 | |
XM_011529907.2 | 1249 | Missense Mutation | AAA,GAA | K,E 128 | XP_011528209.1 | |
XM_011529908.2 | 1249 | Missense Mutation | AAA,GAA | K,E 58 | XP_011528210.2 | |
XM_011529912.2 | 1249 | Intron | XP_011528214.1 | |||
XM_017028602.1 | 1249 | Missense Mutation | AAA,GAA | K,E 128 | XP_016884091.1 | |
XM_017028603.1 | 1249 | Missense Mutation | AAA,GAA | K,E 121 | XP_016884092.1 | |
XM_017028604.1 | 1249 | Missense Mutation | AAA,GAA | K,E 128 | XP_016884093.1 | |
XM_017028605.1 | 1249 | Missense Mutation | AAA,GAA | K,E 128 | XP_016884094.1 | |
XM_017028606.1 | 1249 | Missense Mutation | AAA,GAA | K,E 128 | XP_016884095.1 | |
XM_017028607.1 | 1249 | Missense Mutation | AAA,GAA | K,E 128 | XP_016884096.1 | |
XM_017028608.1 | 1249 | Missense Mutation | AAA,GAA | K,E 128 | XP_016884097.1 | |
XM_017028609.1 | 1249 | Missense Mutation | AAA,GAA | K,E 65 | XP_016884098.1 | |
XM_017028610.1 | 1249 | Missense Mutation | AAA,GAA | K,E 58 | XP_016884099.1 | |
XM_017028611.1 | 1249 | Missense Mutation | AAA,GAA | K,E 128 | XP_016884100.1 | |
XM_017028612.1 | 1249 | Missense Mutation | AAA,GAA | K,E 58 | XP_016884101.1 | |
XM_017028613.1 | 1249 | Missense Mutation | AAA,GAA | K,E 128 | XP_016884102.1 | |
XM_017028614.1 | 1249 | Missense Mutation | AAA,GAA | K,E 128 | XP_016884103.1 | |
XM_017028615.1 | 1249 | Missense Mutation | AAA,GAA | K,E 58 | XP_016884104.1 | |
XM_017028616.1 | 1249 | Missense Mutation | AAA,GAA | K,E 58 | XP_016884105.1 | |
XM_017028617.1 | 1249 | Missense Mutation | AAA,GAA | K,E 58 | XP_016884106.1 | |
XM_017028618.1 | 1249 | Missense Mutation | AAA,GAA | K,E 65 | XP_016884107.1 |
CHCHD10 - coiled-coil-helix-coiled-coil-helix domain containing 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MMP11 - matrix metallopeptidase 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VPREB3 - pre-B lymphocyte 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |