Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCCCAATCATAAAAAAGTCATGAC[C/T]GTCCCTATCTTGCCAATCTGCCAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602750 MIM: 600437 | ||||||||||||||||||||
Literature Links: |
DDT PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DDT - D-dopachrome tautomerase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001084392.1 | Intron | NP_001077861.1 | ||||
NM_001355.3 | Intron | NP_001346.1 |
DDTL - D-dopachrome tautomerase-like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001084393.1 | Intron | NP_001077862.1 | ||||
XM_011529816.2 | Intron | XP_011528118.1 |
GSTT2 - glutathione S-transferase theta 2 (gene/pseudogene) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107985559 - uncharacterized LOC107985559 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |