Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCGCTGCGGAATGTCACAAAGGC[A/G]CAGGGTGGTTGCCCAAAGAGTTTGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609030 MIM: 601180 MIM: 611151 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DGCR8 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DGCR8 - DGCR8 microprocessor complex subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6816 - microRNA 6816 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RANBP1 - RAN binding protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001278639.1 | 529 | Silent Mutation | GCA,GCG | A,A 40 | NP_001265568.1 | |
NM_001278640.1 | 529 | Intron | NP_001265569.1 | |||
NM_001278641.1 | 529 | Intron | NP_001265570.1 | |||
NM_002882.3 | 529 | Intron | NP_002873.1 | |||
XM_011530289.2 | 529 | Intron | XP_011528591.1 | |||
XM_011530290.2 | 529 | Intron | XP_011528592.1 | |||
XM_011530291.2 | 529 | Intron | XP_011528593.1 | |||
XM_017028890.1 | 529 | Intron | XP_016884379.1 | |||
XM_017028891.1 | 529 | Intron | XP_016884380.1 | |||
XM_017028892.1 | 529 | Intron | XP_016884381.1 |
TRMT2A - tRNA methyltransferase 2 homolog A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001257994.1 | 529 | Silent Mutation | TGC,TGT | C,C 111 | NP_001244923.1 | |
NM_022727.5 | 529 | Silent Mutation | TGC,TGT | C,C 111 | NP_073564.3 | |
NM_182984.4 | 529 | Silent Mutation | TGC,TGT | C,C 111 | NP_892029.2 | |
XM_011530139.2 | 529 | Silent Mutation | TGC,TGT | C,C 111 | XP_011528441.1 | |
XM_011530141.1 | 529 | Intron | XP_011528443.1 | |||
XM_011530142.2 | 529 | Intron | XP_011528444.1 | |||
XM_017028770.1 | 529 | Silent Mutation | TGC,TGT | C,C 111 | XP_016884259.1 |