Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCACCTCCAGGGCCTCCAGGTTGC[C/T]GGGTTCCTCTGCAACAACAGGCAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605926 MIM: 610409 | ||||||||||||||||||||
Literature Links: |
BAIAP2L2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BAIAP2L2 - BAI1 associated protein 2 like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PICK1 - protein interacting with PRKCA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC16A8 - solute carrier family 16 member 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013356.2 | 1605 | Missense Mutation | AGC,GGC | S,G 474 | NP_037488.2 | |
XM_017028685.1 | 1605 | Missense Mutation | AGC,GGC | S,G 474 | XP_016884174.1 |