Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGTTCGACTGCTAGGGCAATGTGA[C/T]GCTGAGATCTTCCAGGAGGAGGGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611905 MIM: 600842 MIM: 607386 | ||||||||||||||||||||
Literature Links: |
FNDC4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FNDC4 - fibronectin type III domain containing 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GCKR - glucokinase (hexokinase 4) regulator | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001486.3 | 237 | Silent Mutation | GAC,GAT | D,D 57 | NP_001477.2 | |
XM_011532763.1 | 237 | Silent Mutation | GAC,GAT | D,D 57 | XP_011531065.1 | |
XM_017003796.1 | 237 | Intron | XP_016859285.1 | |||
XM_017003797.1 | 237 | Intron | XP_016859286.1 |
IFT172 - intraflagellar transport 172 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |