Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAGGTACGTACCCAACCATGGGCT[C/T]GCAGGCCCTGCCCCCGGGGCCCATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606605 MIM: 607290 MIM: 606609 | ||||||||||||||||||||
Literature Links: |
ATRIP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATRIP - ATR interacting protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SHISA5 - shisa family member 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TREX1 - three prime repair exonuclease 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_007248.3 | 1144 | Intron | NP_009179.2 | |||
NM_016381.5 | 1144 | Missense Mutation | TCG,TTG | S,L 58 | NP_057465.1 | |
NM_033629.4 | 1144 | Missense Mutation | TCG,TTG | S,L 3 | NP_338599.1 |