Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGCCACTTGCAAGGCCACATTGTC[C/T]GGGCTGGCCCAGCCAGGACCCTCTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 120120 MIM: 191328 | ||||||||||||||||||||
Literature Links: |
COL7A1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COL7A1 - collagen type VII alpha 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA94 - small nucleolar RNA, H/ACA box 94 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UQCRC1 - ubiquinol-cytochrome c reductase core protein I | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003365.2 | 942 | Silent Mutation | CCA,CCG | P,P 299 | NP_003356.2 |