Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCCTACAAGGTCCAGGTAAAGGC[C/T]AGGGCTGCCAGAGCCAGCAGACTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607071 MIM: 603551 MIM: 607052 | ||||||||||||||||||||
Literature Links: |
HYAL1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HYAL1 - hyaluronoglucosaminidase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HYAL2 - hyaluronoglucosaminidase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003773.4 | 1769 | Silent Mutation | CTA,CTG | L,L 467 | NP_003764.3 | |
NM_033158.4 | 1769 | Silent Mutation | CTA,CTG | L,L 467 | NP_149348.2 | |
XM_005265524.2 | 1769 | Silent Mutation | CTA,CTG | L,L 467 | XP_005265581.1 | |
XM_005265525.2 | 1769 | Silent Mutation | CTA,CTG | L,L 467 | XP_005265582.1 |
TUSC2 - tumor suppressor candidate 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |