Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGGCAAGAAAAAATTGCTATAATA[C/T]AATTTGTGTTTATTAGTTTCCACAA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 613447 | |||||||||||||||||||||||
Literature Links: |
CFAP44 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CFAP44 - cilia and flagella associated protein 44 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001164496.1 | 5437 | Intron | NP_001157968.1 | |||
NM_018338.3 | 5437 | Intron | NP_060808.2 | |||
XM_005247617.3 | 5437 | Intron | XP_005247674.1 | |||
XM_006713696.2 | 5437 | Intron | XP_006713759.1 | |||
XM_011512977.2 | 5437 | Intron | XP_011511279.1 | |||
XM_011512978.2 | 5437 | Intron | XP_011511280.1 | |||
XM_011512979.2 | 5437 | Intron | XP_011511281.1 | |||
XM_011512980.2 | 5437 | Intron | XP_011511282.1 | |||
XM_011512981.1 | 5437 | Intron | XP_011511283.1 | |||
XM_011512982.2 | 5437 | Intron | XP_011511284.1 | |||
XM_011512983.2 | 5437 | Intron | XP_011511285.1 | |||
XM_011512984.2 | 5437 | Intron | XP_011511286.1 | |||
XM_017006842.1 | 5437 | Intron | XP_016862331.1 | |||
XM_017006843.1 | 5437 | Intron | XP_016862332.1 | |||
XM_017006844.1 | 5437 | Intron | XP_016862333.1 | |||
XM_017006845.1 | 5437 | Intron | XP_016862334.1 | |||
XM_017006846.1 | 5437 | Intron | XP_016862335.1 | |||
XM_017006847.1 | 5437 | Intron | XP_016862336.1 | |||
XM_017006848.1 | 5437 | Intron | XP_016862337.1 | |||
XM_017006849.1 | 5437 | Intron | XP_016862338.1 |
CFAP44-AS1 - CFAP44 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPICE1 - spindle and centriole associated protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_144718.3 | 5437 | UTR 3 | NP_653319.1 | |||
XM_011512461.2 | 5437 | Intron | XP_011510763.1 | |||
XM_017005775.1 | 5437 | Intron | XP_016861264.1 | |||
XM_017005776.1 | 5437 | Intron | XP_016861265.1 | |||
XM_017005777.1 | 5437 | Intron | XP_016861266.1 | |||
XM_017005778.1 | 5437 | Intron | XP_016861267.1 |