Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTGCTATCACTCTCCTCTTCTTGC[C/T]GGCGTCATTTCTCTCATCCCATCTC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 601024 MIM: 601368 | |||||||||||||||||||||||
Literature Links: |
ABCF3 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ABCF3 - ATP binding cassette subfamily F member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
AP2M1 - adaptor related protein complex 2 mu 1 subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001025205.1 | Intron | NP_001020376.1 | ||||
NM_001311198.1 | Intron | NP_001298127.1 | ||||
NM_004068.3 | Intron | NP_004059.2 |
DVL3 - dishevelled segment polarity protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |