Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGACTGCCACTCTCCGCCCCTACCT[A/G]AGTGCCGTGCGGGCCACATTGCAGG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 604226 MIM: 601982 MIM: 602945 | |||||||||||||||||||||||
Literature Links: |
ARPC4 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ARPC4 - actin related protein 2/3 complex subunit 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001024959.2 | 90 | UTR 5 | NP_001020130.1 | |||
NM_001024960.2 | 90 | UTR 5 | NP_001020131.1 | |||
NM_001198780.1 | 90 | Silent Mutation | CTA,CTG | L,L 28 | NP_001185709.1 | |
NM_005718.4 | 90 | Silent Mutation | CTA,CTG | L,L 9 | NP_005709.1 |
ARPC4-TTLL3 - ARPC4-TTLL3 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198793.1 | 90 | Silent Mutation | CTA,CTG | L,L 9 | NP_001185722.1 |
OGG1 - 8-oxoguanine DNA glycosylase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TADA3 - transcriptional adaptor 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |