Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTATTGAAAAATGCAGTGAAAGTT[C/G]TTAATTTTATTAAAGGAAGCTCATT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600387 MIM: 605655 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BST1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BST1 - bone marrow stromal cell antigen 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004334.2 | 2036 | Intron | NP_004325.2 | |||
XM_005248185.1 | 2036 | Intron | XP_005248242.1 | |||
XM_005248186.1 | 2036 | Intron | XP_005248243.1 | |||
XM_011513878.2 | 2036 | Intron | XP_011512180.1 | |||
XM_011513879.1 | 2036 | Intron | XP_011512181.1 | |||
XM_011513881.2 | 2036 | Intron | XP_011512183.1 | |||
XM_017008565.1 | 2036 | Intron | XP_016864054.1 | |||
XM_017008566.1 | 2036 | Intron | XP_016864055.1 | |||
XM_017008567.1 | 2036 | Intron | XP_016864056.1 |
FAM200B - family with sequence similarity 200 member B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145191.1 | 2036 | Missense Mutation | CTT,GTT | L,V 353 | NP_001138663.1 | |
XM_017008048.1 | 2036 | Missense Mutation | CTT,GTT | L,V 353 | XP_016863537.1 |
FBXL5 - F-box and leucine rich repeat protein 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |