Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCACTGTGGATGGCTTGACTGACCA[C/T]CACGCTGCAGCAATCATGTCGATGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606718 | ||||||||||||||||||||
Literature Links: |
HMGXB3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HMGXB3 - HMG-box containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC26A2 - solute carrier family 26 member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TIGD6 - tigger transposable element derived 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001243253.1 | 1855 | Nonsense Mutation | TGA,TGG | *,W 360 | NP_001230182.1 | |
NM_030953.3 | 1855 | Nonsense Mutation | TGA,TGG | *,W 360 | NP_112215.1 |