Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAAGGTGGAGAGCTGTTGTCCCTCC[A/G]CTATGACCTTACTGTATCCTTTTGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 142810 MIM: 600783 | ||||||||||||||||||||
Literature Links: |
HARS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HARS - histidyl-tRNA synthetase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HARS2 - histidyl-tRNA synthetase 2, mitochondrial | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001278731.1 | 534 | Missense Mutation | CAC,CGC | H,R 104 | NP_001265660.1 | |
NM_001278732.1 | 534 | Intron | NP_001265661.1 | |||
NM_012208.3 | 534 | Missense Mutation | CAC,CGC | H,R 129 | NP_036340.1 | |
XM_011537619.1 | 534 | Missense Mutation | CAC,CGC | H,R 135 | XP_011535921.1 | |
XM_011537620.1 | 534 | Missense Mutation | CAC,CGC | H,R 135 | XP_011535922.1 | |
XM_017009287.1 | 534 | Missense Mutation | CAC,CGC | H,R 129 | XP_016864776.1 | |
XM_017009288.1 | 534 | Missense Mutation | CAC,CGC | H,R 59 | XP_016864777.1 | |
XM_017009289.1 | 534 | Missense Mutation | CAC,CGC | H,R 59 | XP_016864778.1 | |
XM_017009290.1 | 534 | UTR 5 | XP_016864779.1 | |||
XM_017009291.1 | 534 | UTR 5 | XP_016864780.1 | |||
XM_017009292.1 | 534 | UTR 5 | XP_016864781.1 |
ZMAT2 - zinc finger matrin-type 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |