Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGAATCTCCCCCTCATGGAGAGAA[G/T]CTTTGTATGGCTGTCATGCTTAGAC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605447 MIM: 603012 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C6orf48 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C6orf48 - chromosome 6 open reading frame 48 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040437.2 | 390 | Missense Mutation | AGC,ATC | S,I 4 | NP_001035527.1 | |
NM_001040438.2 | 390 | Missense Mutation | AGC,ATC | S,I 4 | NP_001035528.1 | |
NM_001287482.1 | 390 | Missense Mutation | AGC,ATC | S,I 4 | NP_001274411.1 | |
NM_001287483.1 | 390 | Missense Mutation | AGC,ATC | S,I 4 | NP_001274412.1 | |
NM_001287484.1 | 390 | Missense Mutation | AGC,ATC | S,I 4 | NP_001274413.1 | |
NM_001287485.1 | 390 | Missense Mutation | AGC,ATC | S,I 4 | NP_001274414.1 | |
NM_001287486.1 | 390 | Missense Mutation | AGC,ATC | S,I 4 | NP_001274415.1 | |
NM_001287487.1 | 390 | Missense Mutation | AGC,ATC | S,I 4 | NP_001274416.1 | |
NM_001287488.1 | 390 | Missense Mutation | AGC,ATC | S,I 4 | NP_001274417.1 |
HSPA1B - heat shock protein family A (Hsp70) member 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD48 - small nucleolar RNA, C/D box 48 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD52 - small nucleolar RNA, C/D box 52 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |