Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTGGTCTCCTTTGTCCCTAGTTCG[A/G]GAGGCGGAAAAAGATGAGCGCGCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603099 MIM: 609897 MIM: 603298 | ||||||||||||||||||||
Literature Links: |
AGPAT1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AGPAT1 - 1-acylglycerol-3-phosphate O-acyltransferase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006411.3 | 687 | Intron | NP_006402.1 | |||
NM_032741.4 | 687 | Intron | NP_116130.2 | |||
XM_005248805.3 | 687 | Intron | XP_005248862.1 | |||
XM_005248806.2 | 687 | Intron | XP_005248863.1 | |||
XM_011514234.1 | 687 | Intron | XP_011512536.1 |
EGFL8 - EGF like domain multiple 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_030652.3 | 687 | Silent Mutation | CGA,CGG | R,R 202 | NP_085155.1 |
MIR6721 - microRNA 6721 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPT2 - palmitoyl-protein thioesterase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPT2-EGFL8 - PPT2-EGFL8 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |