Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCCAAATATAGCAGTGATGAGGAT[C/G]TGCCCTCCAAACTGGAAGGCTTCAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601833 MIM: 142580 | ||||||||||||||||||||
Literature Links: |
AIF1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AIF1 - allograft inflammatory factor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318970.1 | 187 | UTR 5 | NP_001305899.1 | |||
NM_001623.4 | 187 | Missense Mutation | CTG,GTG | L,V 43 | NP_001614.3 | |
NM_032955.2 | 187 | Intron | NP_116573.1 | |||
XM_005248870.4 | 187 | Missense Mutation | CTG,GTG | L,V 43 | XP_005248927.1 | |
XM_017010332.1 | 187 | UTR 5 | XP_016865821.1 |
PRRC2A - proline rich coiled-coil 2A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA38 - small nucleolar RNA, H/ACA box 38 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |