Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAAGACCCAGGTCTCTTGCTTCTG[A/C]ACCTGCGGGCGCCACGCGGAGAGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609076 MIM: 607882 | ||||||||||||||||||||
Literature Links: |
FBXL6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FBXL6 - F-box and leucine rich repeat protein 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC52A2 - solute carrier family 52 member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM249 - transmembrane protein 249 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001252402.2 | 413 | Silent Mutation | GTG,GTT | V,V 83 | NP_001239331.1 | |
NM_001252404.2 | 413 | Missense Mutation | GCA,TCA | A,S 52 | NP_001239333.1 | |
NM_001280561.1 | 413 | Silent Mutation | GTG,GTT | V,V 83 | NP_001267490.1 |