Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTGGCTTCTGGTGTTGGCAGTGGG[C/T]GGCACAGAGCACGCCTACCGGCCCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603100 MIM: 608582 MIM: 611767 | ||||||||||||||||||||
Literature Links: |
AGPAT2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AGPAT2 - 1-acylglycerol-3-phosphate O-acyltransferase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EGFL7 - EGF like domain multiple 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016215.4 | 131 | Silent Mutation | GGC,GGT | G,G 18 | NP_057299.1 | |
NM_201446.2 | 131 | Silent Mutation | GGC,GGT | G,G 18 | NP_958854.1 | |
XM_006717141.3 | 131 | Silent Mutation | GGC,GGT | G,G 18 | XP_006717204.1 | |
XM_011518764.1 | 131 | Silent Mutation | GGC,GGT | G,G 18 | XP_011517066.1 | |
XM_011518765.1 | 131 | Silent Mutation | GGC,GGT | G,G 18 | XP_011517067.1 | |
XM_011518766.1 | 131 | Silent Mutation | GGC,GGT | G,G 18 | XP_011517068.1 | |
XM_011518767.1 | 131 | Intron | XP_011517069.1 | |||
XM_011518768.1 | 131 | Intron | XP_011517070.1 | |||
XM_017014795.1 | 131 | Intron | XP_016870284.1 | |||
XM_017014796.1 | 131 | Intron | XP_016870285.1 | |||
XM_017014797.1 | 131 | Silent Mutation | GGC,GGT | G,G 18 | XP_016870286.1 | |
XM_017014798.1 | 131 | Intron | XP_016870287.1 | |||
XM_017014799.1 | 131 | Intron | XP_016870288.1 |
HSPC324 - uncharacterized LOC101928612 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR126 - microRNA 126 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |