Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTATTTGTAACTGAGACCCATCC[A/G]TTATTTTCCATCTGAAGCTGGAAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604785 MIM: 603722 | ||||||||||||||||||||
Literature Links: |
CTNNAL1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CTNNAL1 - catenin alpha like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286974.1 | 2346 | UTR 3 | NP_001273903.1 | |||
NM_003798.3 | 2346 | Silent Mutation | AAC,AAT | N,N 719 | NP_003789.1 | |
XM_005252291.3 | 2346 | Silent Mutation | AAC,AAT | N,N 717 | XP_005252348.1 | |
XM_017015250.1 | 2346 | Silent Mutation | AAC,AAT | N,N 542 | XP_016870739.1 | |
XM_017015251.1 | 2346 | Silent Mutation | AAC,AAT | N,N 540 | XP_016870740.1 |
FAM206A - family with sequence similarity 206 member A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017832.3 | 2346 | Intron | NP_060302.1 | |||
XM_011518816.2 | 2346 | Intron | XP_011517118.1 |
IKBKAP - inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |