Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATCGAGGAGTTTACGCGGAAAGGC[A/G]AGGAGGAGAGCCAGAAGGCTGTGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 301770 MIM: 300521 MIM: 300632 | ||||||||||||||||||||
Literature Links: |
ARR3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARR3 - arrestin 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004312.2 | 739 | Missense Mutation | AAG,GAG | K,E 373 | NP_004303.2 | |
XM_017029518.1 | 739 | Missense Mutation | AAG,GAG | K,E 388 | XP_016885007.1 |
KIF4A - kinesin family member 4A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PDZD11 - PDZ domain containing 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB41 - RAB41, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001032726.2 | 739 | Intron | NP_001027898.2 | |||
XM_011530948.2 | 739 | UTR 5 | XP_011529250.1 | |||
XM_017029488.1 | 739 | Intron | XP_016884977.1 |