Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCTTGTCCAGCATCCCGGCTCGTC[A/C]TGAGCCCTTGCTGTTCCCTAGCCAG
Species: |
Human | ||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||
Phenotype: |
MIM: 606236 MIM: 615128 | ||||||||||||||||||||||||||
Literature Links: |
ASPSCR1 PubMed Links | ||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ASPSCR1 - ASPSCR1, UBX domain containing tether for SLC2A4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRC45 - leucine rich repeat containing 45 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STRA13 - stimulated by retinoic acid 13 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001271006.1 | Intron | NP_001257935.1 | ||||
NM_001271007.1 | Intron | NP_001257936.1 | ||||
NM_144998.3 | Intron | NP_659435.2 | ||||
XM_005256339.2 | Intron | XP_005256396.1 | ||||
XM_017024326.1 | Intron | XP_016879815.1 | ||||
XM_017024327.1 | Intron | XP_016879816.1 | ||||
XM_017024328.1 | Intron | XP_016879817.1 | ||||
XM_017024329.1 | Intron | XP_016879818.1 |