Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATAGAAGCATCACAAACTTACAGGG[G/T]CCAGTGCAGTGCTAAAGCTTCTTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
GRPEL2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GRPEL2 - GrpE like 2, mitochondrial | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GRPEL2-AS1 - GRPEL2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCYOX1L - prenylcysteine oxidase 1 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001301054.1 | Intron | NP_001287983.1 | ||||
NM_001301057.1 | Intron | NP_001287986.1 | ||||
NM_024028.3 | Intron | NP_076933.3 | ||||
XM_011537680.1 | Intron | XP_011535982.1 | ||||
XM_011537681.1 | Intron | XP_011535983.1 | ||||
XM_011537682.2 | Intron | XP_011535984.1 |