Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCACAGTAAAGGAGACCTACAGAGG[A/G]CATGGCCCTGCTGAATGGGAGCTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613840 | ||||||||||||||||||||
Literature Links: |
TRAPPC2B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
TRAPPC2B - trafficking protein particle complex 2B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF304 - zinc finger protein 304 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001290318.1 | 763 | Silent Mutation | GGA,GGG | G,G 90 | NP_001277247.1 | |
NM_001290319.1 | 763 | Intron | NP_001277248.1 | |||
NM_020657.3 | 763 | Intron | NP_065708.2 | |||
XM_011527145.2 | 763 | Silent Mutation | GGA,GGG | G,G 48 | XP_011525447.1 | |
XM_017027024.1 | 763 | UTR 5 | XP_016882513.1 |
ZNF547 - zinc finger protein 547 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |