Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTCCATCCAGTTGTTCCCCCCAGA[A/G]CTGGTGAGTCCTTGGGGAGGGGGAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609097 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FBXO24 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FBXO24 - F-box protein 24 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001163499.1 | 1903 | Silent Mutation | GAA,GAG | E,E 33 | NP_001156971.1 | |
NM_012172.4 | 1903 | Silent Mutation | GAA,GAG | E,E 83 | NP_036304.2 | |
NM_033506.2 | 1903 | Silent Mutation | GAA,GAG | E,E 45 | NP_277041.1 | |
XM_005250259.3 | 1903 | Silent Mutation | GAA,GAG | E,E 83 | XP_005250316.1 | |
XM_011516022.1 | 1903 | Silent Mutation | GAA,GAG | E,E 50 | XP_011514324.1 | |
XM_011516023.2 | 1903 | UTR 5 | XP_011514325.1 | |||
XM_017011961.1 | 1903 | Silent Mutation | GAA,GAG | E,E 68 | XP_016867450.1 |
LRCH4 - leucine rich repeats and calponin homology domain containing 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCOLCE-AS1 - PCOLCE antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |