Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGCCTTTCGGAGGAAAGCCAAGTC[A/G]TCAGGGTCACCAACCTCTAGCATAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616456 MIM: 601336 MIM: 611857 MIM: 606961 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
INO80B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
INO80B - INO80 complex subunit B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
INO80B-WBP1 - INO80B-WBP1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MOGS - mannosyl-oligosaccharide glucosidase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001146158.1 | 1513 | Silent Mutation | GAC,GAT | D,D 423 | NP_001139630.1 | |
NM_006302.2 | 1513 | Silent Mutation | GAC,GAT | D,D 529 | NP_006293.2 | |
XM_017004876.1 | 1513 | Silent Mutation | GAC,GAT | D,D 254 | XP_016860365.1 | |
XM_017004877.1 | 1513 | Silent Mutation | GAC,GAT | D,D 254 | XP_016860366.1 |
MRPL53 - mitochondrial ribosomal protein L53 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WBP1 - WW domain binding protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |