Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGCATCTTCCTGGAAGATACGGCC[G/T]GGTGGGTGTTAATCCTCCGCTTTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613368 MIM: 609849 MIM: 601577 MIM: 608939 | ||||||||||||||||||||
Literature Links: |
CARNS1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CARNS1 - carnosine synthase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CORO1B - coronin 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTPRCAP - protein tyrosine phosphatase, receptor type C associated protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS6KB2 - ribosomal protein S6 kinase B2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003952.2 | 544 | Missense Mutation | GGC,TGC | G,C 172 | NP_003943.2 | |
XM_005274164.1 | 544 | Missense Mutation | GGC,TGC | G,C 75 | XP_005274221.1 | |
XM_005274165.4 | 544 | UTR 5 | XP_005274222.1 | |||
XM_006718655.3 | 544 | UTR 5 | XP_006718718.1 | |||
XM_006718656.3 | 544 | UTR 5 | XP_006718719.1 | |||
XM_006718657.1 | 544 | UTR 5 | XP_006718720.1 | |||
XM_017018108.1 | 544 | UTR 5 | XP_016873597.1 |