Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCCACAGGCCTCAGGGTGGCTGCC[A/G]CACCCTCCAGGGCTGTCACCACAAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602640 MIM: 605964 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ARL2-SNX15 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ARL2-SNX15 - ARL2-SNX15 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NAALADL1 - N-acetylated alpha-linked acidic dipeptidase-like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005468.2 | 2205 | Missense Mutation | NP_005459.2 | |||
XM_011544706.2 | 2205 | Missense Mutation | XP_011543008.1 | |||
XM_011544707.2 | 2205 | Missense Mutation | XP_011543009.1 | |||
XM_011544708.2 | 2205 | Missense Mutation | XP_011543010.1 | |||
XM_011544709.2 | 2205 | Intron | XP_011543011.1 | |||
XM_011544710.2 | 2205 | Intron | XP_011543012.1 | |||
XM_011544711.2 | 2205 | Intron | XP_011543013.1 | |||
XM_011544712.2 | 2205 | Intron | XP_011543014.1 |
SAC3D1 - SAC3 domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013299.3 | 2205 | Intron | NP_037431.3 |
SNX15 - sorting nexin 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |