Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCGGAACACGCCGGCCGCCGCGT[C/T]GAAGTCGCCGCCAATGTTGACGAAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614911 MIM: 603846 | ||||||||||||||||||||
Literature Links: |
C1QTNF4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C1QTNF4 - C1q and tumor necrosis factor related protein 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_031909.2 | 910 | Missense Mutation | AAC,GAC | N,D 215 | NP_114115.2 | |
XM_017017165.1 | 910 | Missense Mutation | AAC,GAC | N,D 215 | XP_016872654.1 | |
XM_017017166.1 | 910 | Missense Mutation | AAC,GAC | N,D 215 | XP_016872655.1 |
FAM180B - family with sequence similarity 180 member B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001164379.1 | 910 | Intron | NP_001157851.1 |
NDUFS3 - NADH:ubiquinone oxidoreductase core subunit S3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |